Research
Online Inquiry

T7 RNA Polymerase

Cat.No: IEC-HMM-0057 Datasheet

Quantities:
- +
Product Details Related Products
Product Name T7 RNA Polymerase
Catalog No. IEC-HMM-0057
Description A DNA-dependent RNA polymerase from bacteriophage T7 that exhibits extremely stringent promoter specificity for the T7 promoter sequence (TAATACGACTCACTATAGGG). This enzyme catalyzes 5'-3' synthesis of RNA on a double-stranded DNA template containing the T7 promoter and is the workhorse enzyme for in vitro transcription applications producing milligram quantities of RNA.
Intended Use For in vitro synthesis of RNA transcripts (mRNA, siRNA, guide RNA, ribozymes, RNA aptamers) for structural biology, biochemical studies, RNA vaccines, CRISPR guide RNA production, and RNA labeling with modified nucleotides.
Principle / Technology The enzyme recognizes the 17-base-pair T7 promoter sequence with extremely high affinity. After promoter binding and DNA melting, the polymerase initiates transcription at the +1 guanosine (or adenosine in some constructs) and elongates the transcript processively at ~200-260 nucleotides per second at 37 °C until encountering a termination signal or reaching the template end.
Detection Method Activity measured by incorporation of [α-³²P]-labeled NTPs into acid-insoluble RNA product using a linearized plasmid template with T7 promoter. One unit incorporates 1 nmol NMP in 60 min at 37 °C.
Sample Type Linearized plasmid DNA or PCR product templates containing the T7 promoter sequence upstream of the target transcript sequence.
Performance Range / Specifications Yield: 100-200 ug RNA per ug template DNA in standard 20 uL reaction (2-4 h, 37 °C). Transcript length: 20 bases to >10 kb. Incorporates natural and modified NTPs.
Sensitivity / LOD Detectable RNA synthesis from 50 ng template DNA in a 20 uL reaction.
Specificity Extremely specific for the canonical T7 promoter. Cross-reactivity with T3 or SP6 promoters is negligible.
Reaction Conditions / Protocol 1x T7 buffer, 5 mM each NTP, 10-20 U T7 polymerase, 0.5-1 ug linearized template, 0.5 U inorganic pyrophosphatase (optional). Incubate 37 °C 1-4 h. DNase I treat. Purify RNA.
Components / Formulation T7 RNA Polymerase (50 U/uL) in 50 mM Tris-HCl (pH 7.9), 100 mM NaCl, 1 mM EDTA, 20 mM DTT, 0.1% Triton X-100, 50% glycerol. Supplied with 5x Transcription Buffer.
Storage Conditions Store at -20 °C to -30 °C. Minimize freeze-thaw cycles.
Shelf Life 24 months at -20 °C.
Package Specifications 5,000 U (100 uL), 25,000 U (500 uL), 100,000 U (2 mL). Includes 5x buffer and 100 mM DTT.
Product Form Clear, colorless liquid in glycerol-based buffer with DTT (may have slight sulfurous odor).
Quality Control Each lot tested for: specific activity; RNA yield per ug template (>= 100 ug); absence of contaminating DNase and RNase; RNA product integrity by gel electrophoresis; transcript functionality in downstream applications.
Key Features Highest-yield in vitro transcription polymerase; extremely promoter-specific with minimal background; accepts modified NTPs for functionalized RNA synthesis; scalable from analytical to preparative scale.
Purity >= 95% by SDS-PAGE with Coomassie staining. Single predominant band at ~99 kDa.
Concentration 50 U/uL standard. High-concentration (200 U/uL) and GMP-grade variants available.
Activity / Unit Definition 1 unit incorporates 1 nmol NMP into acid-insoluble RNA in 60 min at 37 °C using T7 promoter-containing linearized plasmid template.
Molecular Weight ~99 kDa (monomer, single polypeptide chain).
Source / Origin Recombinant enzyme expressed in E. coli from bacteriophage T7 gene 1. Animal-origin-free production process.
pH Range / Optimal pH Optimal pH 7.7-8.3 (Tris-HCl). Active range pH 7.0-8.8.
Shipping Conditions Shipped with cold packs. Do not use if arrived thawed and at ambient temperature for >72 h.
Expiration Date / Stability 24 months at -20 °C. 5x buffer and DTT: 24 months at -20 °C.
Regulatory / Compliance ISO 9001 certified manufacturing. GMP-grade product available for therapeutic mRNA production with full regulatory documentation and Drug Master File (DMF) filing support.
Compatibility Compatible with cap analogs (ARCA, CleanCap) for co-transcriptional capping. Compatible with modified NTPs including pseudouridine-5'-triphosphate, N1-methylpseudouridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, biotinylated UTP, and fluorescent NTP conjugates.
Recommended Buffer System 5x Transcription Buffer: 200 mM Tris-HCl (pH 7.9 at 25 °C), 30 mM MgCl₂, 10 mM spermidine, 50 mM NaCl. Supplement with 10 mM DTT (freshly added) before use. Optimize Mg²⁺ concentration (15-25 mM final) for specific templates.
Application Notes / Precautions For maximum yield: include inorganic pyrophosphatase (0.5-1 U) to prevent magnesium pyrophosphate precipitation. Template linearization enzyme must leave blunt or 5'-overhang ends. For long transcripts (>5 kb): reduce incubation temperature to 30 °C and extend time to 16 h. Protect reaction from RNase contamination.
Batch-to-Batch Consistency Lot-to-lot yield variation <= +/- 15% when tested with standardized linearized plasmid template. Purity profile consistent across production batches.

For research use only, not for clinical use.

0
0

There is no product in your cart.