- Home
- IVD
- By Technology Types
- By Diseases Types
- By Product Types
- Research
- Resource
- Distributors
- Company
| Product Name | Lentiviral Packaging Kit |
| Catalog No. | RESK-0605 |
| Description | The Lentiviral Packaging Kit consists of an optimized lentiviral packaging helper plasmid mixture (Lentiviral Mix), an eGFP-expressing control plasmid and a high-efficiency transfection reagent (HG Transgene Reagent). The kit is compatible with second- and third-generation lentiviral packaging plasmids, features a short packaging cycle (purified high-titer lentivirus can be obtained within one week) and delivers high viral titers. It is suitable for preclinical cell-based and whole-animal studies targeting different genes and drug targets, and is ideal for researchers performing viral packaging for the first time. |
| Intended Use | Production of recombinant lentivirus for gene expression studies, RNA interference, promoter activity studies, and preclinical in vitro and in vivo experiments against genes and drug targets. |
| Principle / Technology | Co-transfection of HEK293T cells with the lentiviral transfer vector and the helper plasmid mixture using the HG Transgene Reagent. The Lentiviral Mix expresses all components required for viral packaging: the gag gene encoding the major viral structural proteins, the pol gene encoding virus-specific enzymes, the rev gene encoding a regulator of gag and pol expression, and the VSV-G gene providing the envelope protein. The lentiviral vector contains the essential HIV elements 5' LTR and 3' LTR together with auxiliary elements such as WPRE and cPPT/CTS. The system is compatible with second- and third-generation lentiviral packaging plasmids. |
| Detection Method | Viral titer determined in 293T cells; eGFP fluorescence can be used as a positive transduction control. |
| Sample Type | Endotoxin-free, high-purity plasmid DNA (transfer vector and packaging plasmids); HEK293T/293FT packaging cells. |
| Performance Range / Specifications | Short packaging cycle: purified high-titer lentivirus within one week; high viral titer; virus particles within the obtainable titer range meet the requirements of most in vitro and in vivo experiments. |
| Specificity | Compatible with second- and third-generation lentiviral packaging plasmids. |
| Reaction Conditions / Protocol | 1) One day before transfection, plate well-grown 293T cells in 10 cm dishes; transfect when cells reach ~80% confluence. 2) One to two hours before transfection, replace with fresh medium (12 mL per 10 cm dish); add medium gently to avoid detaching the weakly adherent 293T cells. 3) Prepare the transfection mixture in a sterile tube: 1 mL serum-free DMEM, 10 μg DNA, 10 μL (10 μg) Lentiviral Mix and 60 μL HG Transgene Reagent; mix well, stand at room temperature for 18-20 min, then add dropwise evenly to the dish and culture in a CO2 incubator. 4) Eighteen to twenty hours after transfection, carefully aspirate the medium into disinfectant-containing waste and add 15 mL fresh medium (serum-free DMEM may be used if required). 5) Forty-eight hours after medium replacement, collect the supernatant, centrifuge at 500 x g for 5 min at 4 °C, and filter through a 0.45 μm filter. The virus may be titrated or used directly, or concentrated and purified for higher titer and purity. 6) Aliquot the virus at 40-50 μL per tube and store at -80 °C. |
| Components / Formulation | Lentiviral Mix (1 μg/μL), store at -25 to -15 °C: 100 μL (10 T) / 200 μL (20 T) / 400 μL (40 T) eGFP control plasmid (Amp+), store at -25 to -15 °C: 1.5 μg (all sizes) HG Transgene Reagent, store at 2-8 °C: 0.6 mL (10 T) / 1.2 mL (20 T) / 2 x 1.2 mL (40 T) |
| Storage Conditions | HG Transgene Reagent at 2-8 °C; Lentiviral Mix and eGFP control plasmid at -25 to -15 °C. |
| Shelf Life | 18 months |
| Package Specifications | 10 T, 20 T, 40 T |
| Product Form | Plasmid DNA solutions and liquid transfection reagent |
| Concentration | Lentiviral Mix: 1 μg/μL |
| Shipping Conditions | Shipped with ice packs. |
| Expiration Date / Stability | 18 months when stored as recommended. The HG Transgene Reagent is lipid-based and must not be frozen; do not use it after freezing. Aliquot harvested virus at 40-50 μL and store at -80 °C. |
| Regulatory / Compliance | For research use only. |
| Compatibility | Compatible with second- and third-generation lentiviral packaging plasmids. |
| Recommended Buffer System | Dissolve plasmid DNA in sterile TE buffer or nuclease-free water; use serum-free DMEM to prepare the transfection mixture. |
| Application Notes / Precautions | Only the target plasmid needs to be supplied by the user; the kit already contains the lentiviral vector and an eGFP positive control plasmid. Plasmid sequences and restriction maps are not provided. Ensure plasmid DNA has an A260/A280 ratio of 1.8-2.0. Use cells of low passage number in good condition, free of bacterial, fungal or mycoplasma contamination; after thawing, passage cells twice before packaging. Do not add penicillin-streptomycin during virus packaging, as it impairs packaging efficiency. Culture medium and pipette tips used after transfection contain virus and must be treated with disinfectant before disposal. For suspension cells or weakly adherent cells, polybrene can be used to increase infection efficiency. For stable cell line selection, puromycin or G418 may be used, followed by fluorescence-based sorting. Recommended qPCR primers for the eGFP control plasmid: GFP-qF TGTTCACCGAGTACCCCCAG; GFP-qR CGCCGTAGAACTTGGACTCG. |
For research use only, not for clinical use.
|
There is no product in your cart. |
Copyright © 2026 Alta DiagnoTech. All rights reserved.
