- Home
- IVD
- By Technology Types
- By Diseases Types
- By Product Types
- Research
- Resource
- Distributors
- Company
| Product Name | I-CeuI Homing Endonuclease (5 U/uL) |
| Catalog No. | IVDRM-0597 |
| Description | A homing endonuclease from Chlamydomonas eugametos produced recombinantly in E. coli, I-CeuI specifically recognises and cuts the 27 base pair non-palindromic sequence 5 prime TAACTATAACGGTCCTAAGGTAGCGAA 3 prime, leaving a four base 3 prime cohesive overhang. Because the recognition sequence is so long its chance occurrence in a genome is extremely low, so the enzyme cuts with high specificity and serves targeted genomic operations and molecular cloning. It runs in the shared rapid series buffer at 37°C and is heat inactivated at 80°C for 20 minutes, methylation has no effect on cleavage, and one unit digests 1 microgram of pUC-HE substrate in one hour at 37°C. |
| Intended Use | Targeted genome cleavage and DNA fragment cloning through a rare 27 base pair site |
| Principle / Technology | Recognition and cleavage of a 27 base pair non-palindromic site producing a four base 3 prime overhang |
| Sample Type | Genomic DNA and constructs carrying the I-CeuI recognition site |
| Specificity | 27 base pair non-palindromic recognition sequence with a four base 3 prime overhang; unaffected by methylation |
| Reaction Conditions / Protocol | Digest in 1x rapid series buffer at 37°C and heat inactivate at 80°C for 20 minutes |
| Storage Conditions | -25 to -15°C |
| Shelf Life | 2 years |
| Package Specifications | 250 U |
| Key Features | Longer recognition sequence than I-SceI gives higher targeting specificity; shared rapid series buffer |
| Concentration | 5 U/uL |
| Activity / Unit Definition | 1 U digests 1 ug of pUC-HE substrate in 1 hour at 37°C |
| Readouts / Downstream Assays | Agarose gel analysis of digested DNA |
For in vitro diagnostic use.
|
There is no product in your cart. |
Copyright © 2026 Alta DiagnoTech. All rights reserved.
