- Home
- IVD
- By Technology Types
- By Diseases Types
- By Product Types
- Research
- Resource
- Distributors
- Company
| Product Name | T7 RNA Polymerase In Vitro Transcription Kit, High Yield, 200 U/uL, RNase-Free |
| Catalog No. | NATR-HMM-0154 |
| Description | In vitro transcription kit for high-yield synthesis of RNA from DNA templates containing the T7 RNA polymerase promoter (TAATACGACTCACTATAGGG). T7 RNA polymerase is a single-subunit DNA-dependent RNA polymerase from bacteriophage T7 that specifically recognizes its 17-base promoter sequence with high affinity (Kd ~10^-8 M) and synthesizes RNA transcripts at rates of 200-300 nucleotides per second at 37 C. The kit generates 50-100 ug of RNA from 1 ug of DNA template in 1-2 hours, producing capped or uncapped RNA, labeled RNA (using modified NTPs), and large RNA transcripts up to 15 kb. Applications include: synthesis of mRNA for in vitro translation, transfection, and microinjection; synthesis of RNA probes for northern blot, in situ hybridization, and RNase protection assays; synthesis of guide RNA for CRISPR-Cas9 genome editing; synthesis of RNA standards for RT-qPCR; and preparation of RNA for structural biology (NMR, X-ray crystallography) and biochemical studies. |
| Intended Use | In vitro synthesis of RNA for: mRNA production for transfection, microinjection, and in vitro translation; synthesis of radiolabeled or non-radioactively labeled RNA probes; guide RNA (sgRNA or crRNA) synthesis for CRISPR-Cas9 editing; RNA standards and controls for RT-qPCR; RNA aptamer and ribozyme production; siRNA and shRNA precursor synthesis; antisense RNA; RNA structure-function studies; and synthesis of viral RNA genomes for virology research. |
| Principle / Technology | T7 RNA polymerase is a 99 kDa monomeric enzyme that initiates RNA synthesis at the specific T7 promoter sequence (TAATACGACTCACTATAGGG, where the underlined G is the first nucleotide of the transcript [+1]). The polymerase binds the promoter, melts the DNA duplex, and initiates RNA synthesis de novo (no primer required). Transcription proceeds processively at 200-300 nt/s at 37 C. The reaction reaches a plateau after 2-4 hours due to pyrophosphate accumulation (which complexes Mg2+) or template depletion. Addition of pyrophosphatase (inorganic pyrophosphatase) increases yield by hydrolyzing pyrophosphate, preventing Mg2+ sequestration. |
| Detection Method | 1) Assemble transcription reaction at RT: 1x Transcription Buffer, 7.5 mM each NTP, 10 mM DTT, 1 U/uL RNase inhibitor, 0.5-1 ug linearized DNA template (or 100-500 ng PCR product with T7 promoter), 100-200 U T7 RNA Polymerase, optional pyrophosphatase, water to 20-50 uL; 2) Incubate at 37 C for 1-4 h (2 h typically sufficient for 50-100 ug RNA from 1 ug template); 3) Optional: add DNase I (1 U) and incubate 15 min at 37 C to remove template DNA; 4) Purify RNA by LiCl precipitation, ethanol precipitation, or silica column purification; 5) Quantify RNA by A260 (1 A260 unit = 40 ug/mL ssRNA). |
| Sample Type | Linearized plasmid DNA (1 ug) or PCR product (100-500 ng) with T7 promoter at the 5' end of the coding sequence; template must end with a unique restriction site for runoff transcription or contain a 3' ribozyme sequence for transcript release. |
| Performance Range / Specifications | RNA yield: 50-100 ug RNA per ug DNA template (2 h, 37 C, 20 uL reaction); transcript length: 20 nt to 15 kb; NTP incorporation: >95% of NTPs incorporated into full-length RNA; initiation efficiency: >90% of templates initiate transcription; poly(A) tailing: compatible with E. coli Poly(A) Polymerase for post-transcriptional addition. |
| Sensitivity / LOD | Detectable RNA synthesis from as little as 10 ng DNA template; 0.1-1 ug RNA detectable by gel electrophoresis (EtBr staining). |
| Specificity | T7 RNA polymerase specifically recognizes the bacteriophage T7 promoter (consensus: TAATACGACTCACTATA GGGAGA, bases -17 to +6); no transcription from SP6, T3, or eukaryotic promoters; no transcription in the absence of the T7 promoter; runoff transcription terminates at the end of linear DNA template (non-specific termination). |
| Reaction Conditions / Protocol | Standard reaction: 37 C, 1-4 h at pH 7.9; optimal Mg2+ concentration: 20-24 mM total (free Mg2+ approximately 6-10 mM after NTP chelation); DTT 5-10 mM for reducing environment; NTP concentration 3.75-7.5 mM each; enzyme:template ratio ~100-200 U/ug DNA. |
| Components / Formulation | T7 RNA Polymerase (200 U/uL, in 50 mM Tris-HCl pH 7.9, 100 mM NaCl, 1 mM EDTA, 1 mM DTT, 50% glycerol, 0.1% Triton X-100), 5x Transcription Buffer (400 mM Tris-HCl pH 7.9, 100 mM DTT, 100 mM NaCl, 20 mM spermidine), NTP Mix (25 mM each ATP, CTP, GTP, UTP, pH 7.5), Inorganic Pyrophosphatase (0.1 U/uL), DNase I (RNase-free, 1 U/uL), RNase Inhibitor (40 U/uL), Nuclease-Free Water, Protocol. |
| Storage Conditions | T7 RNA Polymerase, Pyrophosphatase, DNase I, RNase Inhibitor at -20 C; 5x Buffer at -20 C; NTP Mix at -20 C (aliquot to avoid freeze-thaw); water at RT. |
| Shelf Life | 24 months at -20 C; T7 RNA Polymerase retains >90% activity after 24 months. |
| Package Specifications | 1 kit (sufficient for 50 reactions at 20 uL scale): 10,000 U T7 Polymerase (50 uL), buffers and NTPs proportional. |
| Product Form | Liquid enzymes in glycerol-containing storage buffer; frozen liquid buffers; frozen liquid NTP mix. |
| Quality Control | Each lot: T7 RNA polymerase specific activity >=200,000 U/mg; DNase: no conversion of supercoiled plasmid to relaxed/linear (16 h, 37 C); RNase: no degradation of rRNA (1 h, 37 C); transcription yield: >=50 ug RNA/ug DNA template (2 h, 37 C, runoff transcription from linearized pT7 plasmid); full-length transcript: >90% of RNA is full-length (denaturing agarose gel); pyrophosphatase activity: >=10 U/mg. |
| Key Features | High-yield T7 IVT kit (50-100 ug RNA/ug DNA); 200 U/uL enzyme concentration; pyrophosphatase for maximum yield; RNase inhibitor included; DNase I for template removal; NTP mix provided; suitable for 20 nt to 15 kb transcripts. |
| Purity | T7 RNA Polymerase: >99% pure by SDS-PAGE; DNase, RNase not detected; pyrophosphatase: >95% pure; DNase I: >95% pure, RNase, protease free; RNase inhibitor: 40 U/uL. |
| Concentration | T7 RNA Polymerase: 200 U/uL (1 U = amount incorporating 1 nmol NMP into acid-insoluble product in 60 min at 37 C); NTP Mix: 25 mM each; working concentrations: NTPs 3.75-7.5 mM each. |
| Activity / Unit Definition | T7 RNA Polymerase specific activity: >=200,000 U/mg; transcription rate ~200-300 nt/s; pyrophosphatase significantly increases yield (>2-fold) by hydrolyzing inhibitory pyrophosphate. |
| Molecular Weight | T7 RNA Polymerase: ~99 kDa; DNase I: ~31 kDa; pyrophosphatase: ~20 kDa (subunit), ~120 kDa (hexamer); RNase inhibitor: ~50 kDa. |
| Source / Origin | T7 RNA Polymerase: recombinant, E. coli-expressed; pyrophosphatase: recombinant; DNase I: bovine pancreas (animal-derived — may have import restrictions); RNase inhibitor: recombinant (human placental type, E. coli-expressed); NTPs: synthetic; buffers: molecular biology grade. |
| pH Range / Optimal pH | Transcription buffer pH 7.9 (25 C); optimal transcription pH 7.5-8.0; NTPs stable at pH 7.0-8.0. |
| Shipping Conditions | Dry ice (-20 C); enzymes must remain frozen upon receipt. |
| Expiration Date / Stability | 24 months at -20 C; quality retained after 10 freeze-thaw cycles for T7 polymerase; NTP mix: aliquot to avoid freeze-thaw. |
| Regulatory / Compliance | For research use only; not for diagnostic or therapeutic use. Contains bovine-derived DNase I (some countries restrict import of animal-derived products). RNase-free certified. |
| Compatibility | DNA template must contain the T7 promoter (TAATACGACTCACTATAGGG) with the +1 G as the first nucleotide of the transcript. Template can be: linearized plasmid (digested with restriction enzyme generating 5' overhang or blunt end — NOT 3' overhang which initiates non-specific transcription from the recessed 3' end); PCR product with the T7 promoter incorporated in the forward primer; synthetic DNA fragment with T7 promoter. For 5'-capped mRNA: include cap analog (m7G[5']ppp[5']G, 3-4 mM) and reduce GTP to 0.5-1 mM (4:1 cap:GTP ratio typical). For labeled RNA: incorporate biotin-UTP, fluorescein-UTP, digoxigenin-UTP, or [alpha-32P]-NTP. For guide RNA (sgRNA) synthesis: use a template encoding the crRNA-tracrRNA fusion sequence with T7 promoter. |
| Recommended Buffer System | 5x Transcription Buffer: 400 mM Tris-HCl pH 7.9, 100 mM DTT, 100 mM NaCl, 20 mM spermidine; optimal Mg2+ provided by NTP-Mg2+ chelation balance (NTPs at 7.5 mM each, add 20-24 mM MgCl2 if not in buffer). |
| Application Notes / Precautions | All reagents and plasticware must be RNase-free. Use DEPC-treated water or nuclease-free water. Wear gloves and use filter tips. Add RNase inhibitor (1 U/uL final) to prevent RNA degradation. Assemble the reaction at RT — adding components at 4 C may cause spermidine in the buffer to precipitate DNA. The order of addition: water, buffer, DTT, NTPs, template, RNase inhibitor, pyrophosphatase, then T7 polymerase last. For maximum yield, incubate 2-4 h. The yield is template-dependent: some sequences give lower yields due to secondary structure, premature termination, or sequence-specific pausing. For difficult templates, add 1 M betaine or 3% DMSO, or reduce incubation temperature to 30 C (slower but more processive). Remove template DNA with DNase I treatment (15 min, 37 C) after transcription. Purify RNA by LiCl precipitation (7.5 M LiCl, 0.5 volume, -20 C, 30 min) or silica column. The expected RNA yield should be assessed by gel electrophoresis or NanoDrop A260. |
| Batch-to-Batch Consistency | Transcription yield >=50 ug RNA/ug DNA for every lot; T7 activity >=200,000 U/mg; DNase/RNase negative; full-length transcript >90%. |
For research use only, not for clinical use.
|
There is no product in your cart. |
Copyright © 2026 Alta DiagnoTech. All rights reserved.
